Shotgun sequencing

HomePage | Recent changes | View source | Discuss this page | Page history | Log in |

Printable version | Disclaimers | Privacy policy

A method used in genetics for sequencing long DNA strands. The DNA is first cut into small pieces by restriction enzymes. Then the pieces are sequenced individually. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence.

Example:

Original strand         : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
First  shotgun sequence : XXXAGCATGCTGCAG
                                         TCATGCTTAGGCTAXXXX
Second shotgun sequence :                      TTAGGCTAXXXX
                          XXXAGCATGCTGCAGTCATGC
Reconstructed strand    : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

The computational power required to re-align the sequence is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some month nonstop to align all human DNA correctly.

/talk